rs113575051 chr6:40350937 A>C
- Sequence
acactgacacacacacacacaccc[A/C]tggatacacactcccacacataca
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.21 | 1.04 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.91 | -1.71 | 1.17 |
Items per page:
1 – 2 of 2