rs113597604 chr20:58870670 G>T
- Sequence
ctgtgcttttctcaggggaggggt[G/T]gttgggggtttggtctgtttattt
- ASB in cell types
- GM02630 (Fanconi anemi) GM19238 (female B-cells lymphoblastoid cell lines) breast tumor GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.37 | 0.81 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.47 | 0.68 | 1.00 | |||
| breast tumor | 2.21 | -1.25 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.51 | -1.52 | 1.33 |
Items per page:
1 – 4 of 4