rs113618579 chr1:32520957 G>A
- Sequence
gggattacaggcgtgagccactgc[G/A]ccaggccaagtttttttttgtttt
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.29 | 0.79 | 2.01 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 0.92 | 1.03 |
Items per page:
1 – 2 of 2