rs113619607 chr17:81866231 C>T
- Sequence
ggggctgctgcctcggagctcatc[C/T]tccctggctgtgctggtgtctgtc
- ASB in cell types
- BEAS-2B (bronchial epithelium) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- GCR_HUMAN AGO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.98 | 0.07 | 2.00 | n/a | No Hit | |||
| AGO2_HUMAN | -0.44 | 1.58 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid