rs113681229 chr16:87938831 T>G
- Sequence
ctcattcactcattcactcattca[T/G]tcactcattcactcattcattcat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 0.67 | n/a | 2.25 | -6.06 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
