rs113683993 chr1:161439933 G>A
- Sequence
caatccgaggagaaagcctgacct[G/A]gccagtgggcttggccgctgagaa
- ASB in cell types
- neural progenitors
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.34 | 0.70 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Whole_Blood