rs113717991 chr6:148764852 C>T
- Sequence
tgtcagggttcaagagcagagaac[C/T]ggtctgactagaatttgacaggct
- ASB in cell types
- iPS-derived cells during chondrocyte differentiation
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived cells during chondrocyte differentiation | 1.94 | 0.02 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Lung, Pancreas, Whole_Blood