rs113761288 chr11:71251748 G>A
- Sequence
cggctgtggctcagcgcgaccccc[G/A]ggacctgggcgcccgacccgccac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.20 | 1.42 | 1.27 | |||
| breast tumor | 1.70 | -4.38 | 2.00 |
Items per page:
1 – 2 of 2