rs113778443 chr21:34073319 G>A
- Sequence
aggggcaggcagggtcgcgagggg[G/A]cgtgcggccgccgcgagccgctct
- ASB in cell types
- glioblastoma patient-derived cell model T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.08 | 0.10 | 1.03 | -3.01 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
