rs113780182 chr18:13566625 C>T
- Sequence
tccacccgccttggcctcccaaag[C/T]ggtgggattacaggcacgagacgc
- ASB in cell types
- primary B-CLL cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.38 | n/a | 3.00 | |||
| MS-1 (Small cell lung carcinoma) | n/a | 1.57 | 1.00 |
Items per page:
1 – 2 of 2