rs113802615 chr19:14221616 G>A
- Sequence
cagccccgcccggcctgacaccct[G/A]gcggtggcatgatgaagtggtgct
- ASB in cell types
- LNCaP (prostate carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | n/a | 3.46 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.42 | 0.56 | 2.00 |
Items per page:
1 – 2 of 2