rs113807037 chr1:157311524 G>A
- Sequence
ccaccactacctgctgaggctcag[G/A]tgatgtcctcttctctccagacct
- ASB in cell types
- VCaP (prostate carcinoma) GM12890 (Lymphoblastoid Cell Lines) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 2.41 | -1.65 | 2.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.26 | 2.08 | 1.00 | |||
| bipolar neuron | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 3 of 3