rs113813432 chr12:12398726 T>G
- Sequence
ctaggaggcaatactgtgcagacc[T/G]tgtgccaccacctgcctccccctt
- ASB in cell types
- GM02630 (Fanconi anemi) 2588 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.56 | -1.16 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.15 | -0.69 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.95 | 1.28 | 1.00 |
Items per page:
1 – 3 of 3