rs11543 chr10:75210855 G>C
- Sequence
cttcacttcgccctccagctgctg[G/C]agctgcagcccgaccgcgagcgtg
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) TTC-1240 (Rhabdoid tumor of the kidney) SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- RFOX2_HUMAN VEZF1_HUMAN ZN148_HUMAN NELFE_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | 3.42 | -3.25 | 1.00 | n/a | n/a | |||
| VEZF1_HUMAN | 2.52 | -2.00 | 1.17 | n/a | No Hit | |||
| ZN148_HUMAN | 2.88 | -1.23 | 1.25 | n/a | No Hit | |||
| NELFE_HUMAN | 1.22 | -0.64 | 1.50 | n/a | n/a | |||
| ARID2_HUMAN | 1.66 | -0.86 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 9
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Vagina, Whole_Blood