rs11604726 chr11:6481497 C>G
- Sequence
agaagctgaaacggaagtggcgta[C/G]ggcatgcgccggtggcgtgatgga
- ASB in cell types
- K562 (myelogenous leukemia) MDM(monocyte derived macrophages) HCC1806(Squamous cell breast carcinoma, acantholytic variant) upper lobe of left lung
- ASB for transcription factors
- NRF1_HUMAN CREB1_HUMAN FOXK2_HUMAN CREM_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -0.41 | 2.48 | 2.80 | 3.90 | Concordant | |||
| CREB1_HUMAN | -0.54 | 1.19 | 1.38 | 0.51 | Weak Concordant | |||
| FOXK2_HUMAN | -3.12 | 1.99 | 2.00 | n/a | No Hit | |||
| CREM_HUMAN | n/a | 2.31 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.62 | 0.38 | 1.77 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood