rs11698778 chr20:62974417 G>A
- Sequence
gaagtcgaggcatgaatattcagc[G/A]tcgccggctgctggcgcggagccg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.38 | 1.57 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -2.67 | 1.73 | 1.33 |
Items per page:
1 – 2 of 2