rs11699332 chr20:62741470 T>A
- Sequence
tgcaggtggccagagttctcctga[T/A]ggggtccttgcccccagctggctt
- ASB for transcription factors
- CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDN1B_HUMAN | 0.64 | 1.46 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1