rs11699505 chr20:43538611 T>C
- Sequence
agatctgcccggagaggacagggc[T/C]tggctgggcttagtctttaggcct
- ASB in cell types
- adult erythroblasts H929 (plasma cell myeloma)
- ASB for transcription factors
- KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | 2.72 | -4.94 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood