rs11700104 chr20:8751532 G>A
- Sequence
tggtccatctgtattctattttca[G/A]tgcacttctgttcattttggaatt
- ASB in cell types
- Peyer's patch tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 2.05 | -0.35 | 1.12 | |||
| tibial artery | 2.41 | -2.01 | 1.00 |
Items per page:
1 – 2 of 2