rs11700764 chr21:29018236 C>T
- Sequence
acatgagacacggaagaatgactc[C/T]ggggctttaaggtactgaaagtat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.52 | 0.87 | 1.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adp-stimulated platelet aggregation after clopidogrel, apob (apolipoprotein b), birth weight, body mass index (bmi), cystatin c in serum, height, homa-b, lp-pla2 activity, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid