rs11700925 chr21:34865359 C>T
- Sequence
gatggggctgctaccaggcctaaa[C/T]gcaacttgaacttcaagttcaagt
- ASB in cell types
- HepG2 (hepatoblastoma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.20 | 0.97 | 1.18 | |||
| MS-1 (Small cell lung carcinoma) | -2.24 | 2.50 | 1.00 |
Items per page:
1 – 2 of 2