rs11701439 chr21:43824358 A>G
- Sequence
ctccttttctaattcggtggtgag[A/G]cagcaaagctgagcctagagtggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RING2_HUMAN MIER1_HUMAN HDAC2_HUMAN MGAP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | 4.00 | -3.88 | 1.00 | n/a | n/a | |||
| MIER1_HUMAN | 3.29 | -2.95 | 1.00 | n/a | n/a | |||
| HDAC2_HUMAN | 3.19 | n/a | 1.00 | n/a | n/a | |||
| MGAP_HUMAN | 3.02 | -3.16 | 1.00 | n/a | No Hit | |||
| ARI1B_HUMAN | 1.81 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood