rs11702683 chr21:37916461 T>C
- Sequence
acgcggctccgagataaaagcgag[T/C]gcagcgccgcgtgctggggaaaaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) glioblastoma patient-derived cell model foreskin keratinocyte
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.02 | 1.76 | 1.14 | n/a | n/a |
Items per page:
1 – 1 of 1