rs11703638 chr22:41666763 G>A
- Sequence
ggacttgggcaacctcagatttgg[G/A]tatccgcatggagtgccctctggc
- ASB in cell types
- pancreas primary B-CLL cells HEK293 (embryonic kidney)
- ASB for transcription factors
- ELF1_HUMAN IKZF1_HUMAN HIC1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -1.60 | 1.87 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.67 | 1.66 | 1.44 | n/a | n/a | |||
| HIC1_HUMAN | 1.93 | n/a | 2.00 | n/a | No Hit | |||
| BRD4_HUMAN | 1.97 | 0.77 | 1.50 | n/a | n/a | |||
| NFAC3_HUMAN | 2.41 | -2.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, body mass index (bmi), chronic kidney disease, infant head circumference, ldl cholesterol change with statins, serum creatinine, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood