rs11705639 chr22:30435865 G>A
- Sequence
ggtgcacttcctggctctgctggc[G/A]cacttcctgcctctgctggtgcac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) macrophages form periferal blood monocyte-derived dendritic cells
- ASB for transcription factors
- ZBT40_HUMAN IKZF1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT40_HUMAN | -2.69 | 3.01 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | -1.28 | 3.65 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | 2.37 | 0.19 | 1.92 | 0.25 | Weak Discordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood