rs11707295 chr3:194854457 G>A
- Sequence
tcttggactttattgtctggctgc[G/A]tgtattgatgtgtttctttgtttt
- ASB in cell types
- 22RV1 (prostate carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.35 | n/a | 2.00 | |||
| VCaP (prostate carcinoma) | 0.36 | 0.89 | 2.02 |
Items per page:
1 – 2 of 2