rs11708067 chr3:123346931 A>G
- Sequence
gtggaactcataagcagattttgc[A/G]ctctattaatctacatctgtttgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.93 | -0.35 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.48 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI fasting blood glucose, fasting blood glucose (bmi interaction), glycated hemoglobin levels, homeostasis model assessment of beta-cell function, type 2 diabetes
GRASP 2 hour glucose, 2-hour glucose tolerance test, adiponectin levels, birth weight, birth weight and 2-hour glucose, birth weight and fasting glucose, birth weight and log [fasting insulin (pmol/l)], birth weight and log[fasting proinsulin (pmol/l)] , birth weight and log[homa-b], birth weight and type 2 diabetes, body mass index (bmi), fasting blood glucose, fasting blood glucose in high bmi subjects, fasting blood glucose in low bmi subjects, fasting insulin, glycated hemoglobin (hba1c), height, homa-b, total cholesterol, type 2 diabetes, type 2 diabetes (females), type 2 diabetes (males), type 2 diabetes in lean individuals (bmi<25 kg/m2), type 2 diabetes in obese individuals (bmi>30 kg/m2)