rs11709137 chr3:16121936 A>C
- Sequence
gcatgaggaaacggtgtcatcttt[A/C]ccagttcctgattttccagtggca
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -1.66 | 2.26 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, mitral annular calcium, weight loss after gastric bypass surgery