rs11710115 chr3:120181938 G>T
- Sequence
gcaagactgcatctgactagaagg[G/T]atgggccttcaaaaaatttacaca
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.02 | 1.60 | 2.00 |
Items per page:
1 – 1 of 1