rs117106710 chr7:5670829 T>C
- Sequence
ttatgtggcctacccgggaggaac[T/C]tgtagtggtggccatataaggagg
- ASB in cell types
- macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.83 | -5.36 | 2.00 | -0.85 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Thyroid, Whole_Blood