rs11711952 chr3:196528863 G>C
- Sequence
ggtggttccgccctgtcgggctca[G/C]accggcctgggcgcctccgcgggg
- ASB in cell types
- HT1080 (fibrosarcoma) Kelly (neuroblastoma) pancreas tibial artery
- ASB for transcription factors
- CTCF_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.45 | 0.69 | 1.83 | n/a | No Hit | |||
| ESR1_HUMAN | 1.96 | -0.45 | 3.33 | -0.17 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood