rs11714638 chr3:61316112 G>C
- Sequence
cctcctgcccagagattgcccttg[G/C]gggagtttgctcagactctggcca
- ASB in cell types
- Jurkat (T-cells) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | 3.87 | n/a | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.09 | 1.54 | 1.36 |
Items per page:
1 – 2 of 2