rs11717050 chr3:11061023 G>A
- Sequence
aggtacctgaagcgaggctcggcc[G/A]gaggcttcgggcagagatgtgctg
- ASB in cell types
- A549 (lung carcinoma) T47D (invasive ductal carcinoma) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.56 | 1.10 | 1.80 | n/a | n/a |
Items per page:
1 – 1 of 1