rs11717244 chr3:4759333 C>T
- Sequence
ttgttattcttttaatctaagacc[C/T]ggattcattggcccctctacagct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.69 | 0.31 | 1.16 | |||
| A549 (lung carcinoma) | 2.23 | -1.15 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, birth weight, hdl cholesterol, homa-b, triglycerides change with statins