rs11717775 chr3:149568981 C>T
- Sequence
ggggtttcaccgtgttagccatca[C/T]ggtctcgatctcctgacctcgtga
- ASB in cell types
- glioblastoma cells H929 (plasma cell myeloma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 0.21 | 2.92 | 1.33 | |||
| H929 (plasma cell myeloma) | -2.09 | 2.49 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.60 | 0.17 | 1.10 |
Items per page:
1 – 3 of 3