rs117183946 chr12:95073122 C>T
- Sequence
gggggttgtgtgctccaagccgct[C/T]gccgtccggccccgcgtcccgccg
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.20 | 0.92 | 2.03 | |||
| breast tumor | 2.11 | -4.57 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.56 | 0.79 | 1.13 |
Items per page:
1 – 3 of 3