rs11719594 chr3:122943016 G>T
- Sequence
ggtaggtgaggtccttcgggaaag[G/T]ttctacccctacccagccgtccca
- ASB in cell types
- Kelly (neuroblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 0.10 | 1.54 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.30 | 0.94 | 1.36 |
Items per page:
1 – 2 of 2