rs117208283 chr12:114555459 G>A
- Sequence
acacattaaacaaacagaagttaa[G/A]tagaaaaggacaagaatttcctaa
- ASB in cell types
- 22RV1 (prostate carcinoma) MDA-MB-453 (breast adenocarcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.59 | -3.94 | 2.00 | |||
| MDA-MB-453 (breast adenocarcinoma) | -0.34 | 1.71 | 1.25 | |||
| LHSAR (prostate epithelial cells) | -1.11 | 1.69 | 1.50 |
Items per page:
1 – 3 of 3