rs11721211 chr3:18745379 G>A
- Sequence
ttcaaatatctttaaacaagaaga[G/A]attgccttttacatgtaattcaac
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.83 | -0.27 | 2.00 | |||
| MDM(monocyte derived macrophages) | -3.05 | 1.78 | 2.00 |
Items per page:
1 – 2 of 2