rs11722603 chr4:52103566 A>G
- Sequence
atgttgcttaggaaatgagaggat[A/G]ccagcagttagtaataagattcaa
- ASB in cell types
- neural cell primary foreskin fibroblasts Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.27 | 0.98 | 1.00 | |||
| primary foreskin fibroblasts | 2.27 | -2.27 | 1.00 | |||
| Kelly (neuroblastoma) | 0.23 | 1.21 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), obesity (body mass index (bmi)), rheumatoid arthritis, systolic blood pressure (sbp), triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Spleen, Testis, Thyroid