rs11722737 chr4:15457819 C>T
- Sequence
catttccagagattatgtaaaatc[C/T]aagtgcgggctaggagaaacttta
- ASB in cell types
- foreskin keratinocyte neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.66 | n/a | 2.33 | |||
| neutrophils from periferal blood | 2.54 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, birth weight, college completion, cystatin c in serum, height, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood