rs11722918 chr4:41232407 C>T
- Sequence
ggaagaatttgtaaagggcagctt[C/T]ggtggggaacttccattttgagga
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.25 | 0.01 | 1.21 | n/a | No Hit | |||
| STAG1_HUMAN | 1.29 | 0.73 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), body mass index (bmi), diastolic blood pressure (dbp), fasting blood glucose, lesion load (multiple sclerosis), neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, rheumatoid arthritis, systolic blood pressure (sbp)