rs11723016 chr4:10124565 A>G
- Sequence
gtgcctgcactatatctgcctggc[A/G]aaggaatcactgaggaagtgactg
- ASB in cell types
- macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 0.30 | 2.57 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, microalbuminuria, serum urate, uric acid, urinary albumin-to-creatinine ratio