rs117233406 chr6:151948618 C>A
- Sequence
tctccttcccctttcctgccgagt[C/A]cccctctaatcaacactctagaag
- ASB in cell types
- THP-1 (acute monocytic leukemia) macrophages form periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.07 | 1.53 | 1.83 | |||
| macrophages form periferal blood | 2.42 | -0.10 | 2.00 | |||
| monocyte-derived dendritic cells | 2.14 | n/a | 2.00 |
Items per page:
1 – 3 of 3