rs117246563 chr16:14378392 A>G
- Sequence
acgggttccactctggccacggag[A/G]tgagcttactgaggctggaagggg
- ASB in cell types
- HMLE-Twist-ER (breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMLE-Twist-ER (breast cancer) | -2.22 | 2.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg