rs11725396 chr4:25064736 A>G
- Sequence
aaggtagagctgaataatcacaat[A/G]gaatccatgaggcccacagagctg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZBT40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT40_HUMAN | 0.92 | 2.84 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, barnes akathisia rating scale, homa-ir, infant head circumference, ldl cholesterol, tardive dyskinesia, total cholesterol