rs11725428 chr4:154854574 G>T
- Sequence
tcctgcagggggaaacatcctcca[G/T]tttatgaggaataaaatatatatc
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells) epithelial cell of prostate
- ASB for transcription factors
- STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.57 | 0.27 | 1.06 | n/a | n/a | |||
| RAD21_HUMAN | 1.52 | -0.32 | 1.30 | n/a | n/a |
Items per page:
1 – 2 of 2