rs11726271 chr4:10096568 G>A
- Sequence
aatgaagcctgtttcactacgaac[G/A]gggcatccttggaaagccccctcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RELB_HUMAN | -2.75 | 2.65 | 1.00 | -3.42 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid