rs11726574 chr4:7349129 C>A
- Sequence
tggtgcttgcagtatgttagcata[C/A]ttcatcattgcgcaaggtttggag
- ASB in cell types
- macrophages K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 1.87 | -5.33 | 2.50 | |||
| K562 (myelogenous leukemia) | -0.26 | 1.52 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins