rs11727104 chr4:6180990 G>A
- Sequence
agaaaaggccccagccatcaggtc[G/A]tttctgtctcacctctgctgaaat
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.23 | -0.17 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 2.38 | 1.50 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.07 | 0.70 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Transverse, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Spleen, Whole_Blood